Stem-loop sequence hsa-mir-3616

AccessionMI0016006 (change log)
Symbol HGNC:MIR3616
DescriptionHomo sapiens miR-3616 stem-loop
Literature search

1 open access papers mention hsa-mir-3616
(1 sentences)

Stem-loop
   u    -       a              a   a         ugc 
5'  guca cuccgcc gcaucaugaagugc cuc ugauauguu   c
    |||| ||||||| |||||||||||||| ||| |||||||||   c
3'  cggu ggggcgg cguaguacuuuacg gag acugugcga   c
   a    u       a              g   c         cua 
Get sequence
Deep sequencing
461 reads, 2.04 reads per million, 98 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 47166967-47167058 [+]
intergenic
Database links

Mature sequence hsa-miR-3616-5p

Accession MIMAT0017995
Sequence

19 - 

augaagugcacucaugauaugu

 - 40

Get sequence
Deep sequencing215 reads, 68 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-3616-3p

Accession MIMAT0017996
Sequence

60 - 

cgagggcauuucaugaugcaggc

 - 82

Get sequence
Deep sequencing243 reads, 64 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1