Stem-loop sequence hsa-mir-3614

AccessionMI0016004 (change log)
Symbol HGNC:MIR3614
DescriptionHomo sapiens miR-3614 stem-loop
Literature search

9 open access papers mention hsa-mir-3614
(75 sentences)

Stem-loop
   gguucuguc ug gc    u                  uuug 
5'          u  g  cacu ggaucugaaggcugcccc    c
            |  |  |||| ||||||||||||||||||     
3'          a  u  gugg ucuagacuuccgaugggg    u
   ucauucuua gu uu    u                  ucuc 
Get sequence
Deep sequencing
854 reads, 19.8 reads per million, 101 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 56891270-56891355 [-]
antisense
OTTHUMT00000445458 ; PPM1E-001; intron 1
ENST00000308249 ; PPM1E-001; intron 1
Database links

Mature sequence hsa-miR-3614-5p

Accession MIMAT0017992
Sequence

15 - 

ccacuuggaucugaaggcugccc

 - 37

Get sequence
Deep sequencing596 reads, 69 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

Mature sequence hsa-miR-3614-3p

Accession MIMAT0017993
Sequence

53 - 

uagccuucagaucuugguguuuu

 - 75

Get sequence
Deep sequencing236 reads, 70 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).