Stem-loop sequence hsa-mir-3613

AccessionMI0016003 (change log)
Symbol HGNC:MIR3613
DescriptionHomo sapiens miR-3613 stem-loop
Gene family MIPF0001411; mir-3613
Literature search

10 open access papers mention hsa-mir-3613
(23 sentences)

Stem-loop
   u  uug   u    uu    ua               g ugc 
5'  gg   ggu ugga  guug  cuuuuuuuuuuguuc u   a
    ||   ||| ||||  ||||  ||||||||||||||| |   u
3'  cu   cca acuu  caac  gaaaaaaaaaacaag a   u
   a  uca   c    cc    cc               g uuu 
Get sequence
Deep sequencing
144678 reads, 321 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 49996415-49996501 [-]
sense
OTTHUMT00000044910 ; CAB39L-003; intron 3
OTTHUMT00000335456 ; CAB39L-005; intron 3
OTTHUMT00000335458 ; CAB39L-007; intron 3
ENST00000347776 ; CAB39L-201; intron 2
ENST00000409308 ; CAB39L-003; intron 3
ENST00000410043 ; CAB39L-005; intron 3
ENST00000470410 ; CAB39L-007; intron 3
Database links

Mature sequence hsa-miR-3613-5p

Accession MIMAT0017990
Sequence

16 - 

uguuguacuuuuuuuuuuguuc

 - 37

Get sequence
Deep sequencing141419 reads, 150 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3613-3p

Accession MIMAT0017991
Sequence

53 - 

acaaaaaaaaaagcccaacccuuc

 - 76

Get sequence
Deep sequencing3251 reads, 148 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1