Stem-loop sequence hsa-mir-3612

AccessionMI0016002 (change log)
Symbol HGNC:MIR3612
DescriptionHomo sapiens miR-3612 stem-loop
Gene family MIPF0001519; mir-3612
Stem-loop
      a      a  --    g  a   u a   a      gaaug 
5' ggg cugggg ug  agga gc ucu g gaa uggaag     g
   ||| |||||| ||  |||| || ||| | ||| ||||||      
3' cuc gauccc ac  uccu cg aga c cuu accuuc     g
      -      c  ag    g  g   u a   g      aucua 
Get sequence
Deep sequencing
125 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 128294092-128294178 [+]
antisense
OTTHUMT00000399697 ; RP11-749H20.1-001; intron 1
ENST00000541797 ; RP11-749H20.1-001; intron 1
Database links

Mature sequence hsa-miR-3612

Accession MIMAT0017989
Sequence

14 - 

aggaggcaucuugagaaaugga

 - 35

Get sequence
Deep sequencing75 reads, 33 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1