Stem-loop sequence hsa-mir-3611

AccessionMI0016001 (change log)
Symbol HGNC:MIR3611
DescriptionHomo sapiens miR-3611 stem-loop
Stem-loop
         u   a            uu           augaa 
5' agcagg cua uaagaauuucuu  ucuucacaauu     a
   |||||| ||| ||||||||||||  |||||||||||     g
3' ucguuu gau auucuuaaagaa  agaaguguuaa     a
         u   c            --           agaaa 
Get sequence
Deep sequencing
1189 reads, 4.76 reads per million, 126 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 35079598-35079680 [-]
sense
OTTHUMT00000047527 ; PARD3-002; intron 1
OTTHUMT00000047528 ; PARD3-003; intron 1
OTTHUMT00000047529 ; PARD3-004; intron 1
OTTHUMT00000047530 ; PARD3-005; intron 1
OTTHUMT00000047531 ; PARD3-006; intron 1
OTTHUMT00000047535 ; PARD3-010; intron 1
OTTHUMT00000047526 ; PARD3-001; intron 1
OTTHUMT00000047534 ; PARD3-009; intron 1
ENST00000374789 ; PARD3-002; intron 1
ENST00000374788 ; PARD3-003; intron 1
ENST00000346874 ; PARD3-004; intron 1
ENST00000374794 ; PARD3-005; intron 1
ENST00000350537 ; PARD3-006; intron 1
ENST00000374790 ; PARD3-010; intron 1
ENST00000374776 ; PARD3-001; intron 1
ENST00000374773 ; PARD3-009; intron 1
ENST00000545693 ; PARD3-204; intron 1
ENST00000545260 ; PARD3-203; intron 1
ENST00000340077 ; PARD3-201; intron 1
Database links

Mature sequence hsa-miR-3611

Accession MIMAT0017988
Sequence

52 - 

uugugaagaaagaaauucuua

 - 72

Get sequence
Deep sequencing985 reads, 119 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1