Stem-loop sequence hsa-mir-3610

AccessionMI0016000 (change log)
Symbol HGNC:MIR3610
DescriptionHomo sapiens miR-3610 stem-loop
Literature search

2 open access papers mention hsa-mir-3610
(5 sentences)

Stem-loop
   aaga     g   uaa    a   a    guuug     g 
5'     gccgc gcg   cggc gcc ucuu     uuuga u
       ||||| |||   |||| ||| ||||     ||||| g
3'     cggcg ugu   gccg cgg agga     aggcu a
   ---g     g   -cg    -   -    ----a     a 
Get sequence
Deep sequencing
213 reads, 13.6 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 116874728-116874800 [-]
intergenic
Database links

Mature sequence hsa-miR-3610

Accession MIMAT0017987
Sequence

42 - 

gaaucggaaaggaggcgccg

 - 61

Get sequence
Deep sequencing193 reads, 56 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1