Stem-loop sequence hsa-mir-3609

AccessionMI0015999 (change log)
Symbol HGNC:MIR3609
DescriptionHomo sapiens miR-3609 stem-loop
Literature search

1 open access papers mention hsa-mir-3609
(3 sentences)

Stem-loop
   --  aa    aacuu      -       ccu           
5'   gu  cagu     uuauuc ucauuuu   uuucucuacc 
     ||  ||||     |||||| |||||||   ||||||||| u
3'   cg  gucg     aaugag agugaaa   gaagagaugu 
   cc  ag    gucau      u       --c           
Get sequence
Deep sequencing
2446 reads, 73.1 reads per million, 134 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 98881650-98881729 [+]
sense
OTTHUMT00000335176 ; MYH16-001; intron 25
ENST00000330888 ; MYH16-201; intron 6
ENST00000439784 ; MYH16-001; intron 25
Database links

Mature sequence hsa-miR-3609

Accession MIMAT0017986
Sequence

51 - 

caaagugaugaguaauacuggcug

 - 74

Get sequence
Deep sequencing2420 reads, 134 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1