Stem-loop sequence hsa-mir-3607

AccessionMI0015997 (change log)
Symbol HGNC:MIR3607~withdrawn
DescriptionHomo sapiens miR-3607 stem-loop
Gene family MIPF0001566; mir-3607
Stem-loop
   aagguu cg      gu  ug    -aaau      ga   a 
5'       g  gugcau  ga  aagc     caguau  aug a
         |  ||||||  ||  ||||     ||||||  |||  
3'       c  caugua  cu  uucg     gucaua  uac u
   ---acu au      gu  --    caaau      -g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-3607-5p

Accession MIMAT0017984
Sequence

12 - 

gcaugugaugaagcaaaucagu

 - 33

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3607-3p

Accession MIMAT0017985
Sequence

51 - 

acuguaaacgcuuucugaug

 - 70

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1