Stem-loop sequence hsa-mir-3606

AccessionMI0015996 (change log)
Symbol HGNC:MIR3606
DescriptionHomo sapiens miR-3606 stem-loop
Stem-loop
   uuguugcuau      u        cu       u 
5'           cuaggu agugaagg  auuuuaa u
             |||||| ||||||||  ||||||| u
3'           gauuca ucacuuuc  uaaaauu u
   ---------g      -        uu       u 
Get sequence
Deep sequencing
314 reads, 9.52 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 188995630-188995692 [+]
antisense
OTTHUMT00000334695 ; AC068718.1-001; intron 2
ENST00000434418 ; LINC01090-001; intron 2
Database links

Mature sequence hsa-miR-3606-5p

Accession MIMAT0017983
Previous IDshsa-miR-3606
Sequence

16 - 

uuagugaaggcuauuuuaauu

 - 36

Get sequence
Deep sequencing289 reads, 54 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3606-3p

Accession MIMAT0022965
Sequence

42 - 

aaaauuucuuucacuacuuag

 - 62

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence not experimental
Predicted targets

References

1