Stem-loop sequence hsa-mir-3605

AccessionMI0015995 (change log)
Symbol HGNC:MIR3605
DescriptionHomo sapiens miR-3605 stem-loop
Gene family MIPF0001639; mir-3605
Literature search

5 open access papers mention hsa-mir-3605
(13 sentences)

Stem-loop
   acuuuauac    aauugugau        a     a   a    cucccac 
5'          gugu         gaggaugg uagca gga gccg       c
            ||||         |||||||| ||||| ||| ||||       u
3'          cgca         cuccuguc auugu ccu cggc       g
   ------gcu    -ggguggau        c     g   c    acuccca 
Get sequence
Deep sequencing
2438 reads, 1.41 reads per million, 142 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 33332393-33332492 [-]
sense
OTTHUMT00000011467 ; FNDC5-001; intron 4
OTTHUMT00000011472 ; FNDC5-006; intron 4
ENST00000373471 ; FNDC5-001; intron 4
ENST00000496770 ; FNDC5-006; intron 4
ENST00000609187 ; FNDC5-201; intron 4
Database links

Mature sequence hsa-miR-3605-5p

Accession MIMAT0017981
Sequence

22 - 

ugaggauggauagcaaggaagcc

 - 44

Get sequence
Deep sequencing1789 reads, 124 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-3605-3p

Accession MIMAT0017982
Sequence

66 - 

ccuccguguuaccuguccucuag

 - 88

Get sequence
Deep sequencing630 reads, 104 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).