Stem-loop sequence hsa-mir-3529

AccessionMI0017351 (change log)
Symbol HGNC:MIR3529
DescriptionHomo sapiens miR-3529 stem-loop
Gene family MIPF0001261; mir-3529
Literature search

2 open access papers mention hsa-mir-3529
(5 sentences)

Stem-loop
      a     a  u       -     -       ag gc 
5' ggc ccauu gg agacugg gauuu guuguug  c  a
   ||| ||||| || ||||||| ||||| |||||||  |  g
3' ccg gguag cc ucugauc cuaaa caacaac  g  u
      g     a  u       a     a       -a aa 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 88611847-88611924 [-]
sense
OTTHUMT00000416155 ; NTRK3-017; intron 1
OTTHUMT00000415275 ; NTRK3-004; intron 10
OTTHUMT00000416153 ; NTRK3-015; intron 10
OTTHUMT00000415277 ; NTRK3-003; intron 11
OTTHUMT00000403049 ; NTRK3-002; intron 11
OTTHUMT00000309066 ; NTRK3-001; intron 13
ENST00000558306 ; NTRK3-017; intron 1
ENST00000557856 ; NTRK3-004; intron 10
ENST00000558676 ; NTRK3-015; intron 10
ENST00000542733 ; NTRK3-003; intron 11
ENST00000540489 ; NTRK3-002; intron 11
ENST00000357724 ; NTRK3-203; intron 11
ENST00000360948 ; NTRK3-204; intron 12
ENST00000355254 ; NTRK3-202; intron 12
ENST00000317501 ; NTRK3-201; intron 12
ENST00000394480 ; NTRK3-001; intron 13
Clustered miRNAs
< 10kb from hsa-mir-3529
hsa-mir-3529chr15: 88611847-88611924 [-]
hsa-mir-7-2chr15: 88611825-88611934 [+]
hsa-mir-1179chr15: 88608107-88608197 [+]
Database links

Mature sequence hsa-miR-3529-5p

Accession MIMAT0019828
Previous IDshsa-miR-3529
Sequence

10 - 

agguagacugggauuuguuguu

 - 31

Get sequence
Deep sequencing29 reads, 17 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3529-3p

Accession MIMAT0022741
Sequence

46 - 

aacaacaaaaucacuagucuucca

 - 69

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).