Stem-loop sequence hsa-mir-3202-1

AccessionMI0014252 (change log)
Symbol HGNC:MIR3202-1
DescriptionHomo sapiens miR-3202-1 stem-loop
Gene family MIPF0000846; mir-3202
Stem-loop
                                  -a      u 
5' uauuaauauggaagggagaagagcuuuaaug  uuggag c
   |||||||||||||||||||||||||||||||  ||||||  
3' guaauuauaccuucccucuucucgaaauuac  gacuuu a
                                  ga      u 
Get sequence
Deep sequencing
586 reads, 1.19 reads per million, 84 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 153981097-153981177 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3202-1
hsa-mir-3202-1chrX: 153981097-153981177 [+]
hsa-mir-3202-2chrX: 153981098-153981176 [-]
Database links

Mature sequence hsa-miR-3202

Accession MIMAT0015089
Sequence

9 - 

uggaagggagaagagcuuuaau

 - 30

Get sequence
Deep sequencing1098 reads, 72 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).