Stem-loop sequence hsa-mir-3200

AccessionMI0014249 (change log)
Symbol HGNC:MIR3200
DescriptionHomo sapiens miR-3200 stem-loop
Gene family MIPF0001441; mir-3200
Literature search

3 open access papers mention hsa-mir-3200
(12 sentences)

Stem-loop
     u   -    g a       aa      ca    uu   uc aa 
5' gg ggu cgag g aucugag  ggcgca  aggu  gug  c  u
   || ||| |||| | |||||||  ||||||  ||||  |||  |   
3' uc ccg gcuc u uggacuc  ucgcgu  ucca  cac  g  a
     -   u    g c       -a      --    --   cu ac 
Get sequence
Deep sequencing
3896 reads, 3.52 reads per million, 142 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 30731557-30731641 [+]
antisense
OTTHUMT00000320916 ; SF3A1-001; intron 14
ENST00000215793 ; SF3A1-001; intron 14
ENST00000439242 ; SF3A1-201; intron 14
Database links

Mature sequence hsa-miR-3200-5p

Accession MIMAT0017392
Sequence

13 - 

aaucugagaaggcgcacaaggu

 - 34

Get sequence
Deep sequencing811 reads, 93 experiments
Evidence experimental; Illumina [2-3,5], Northern [4]
Database links
Predicted targets

Mature sequence hsa-miR-3200-3p

Accession MIMAT0015085
Previous IDshsa-miR-3200
Sequence

54 - 

caccuugcgcuacucaggucug

 - 75

Get sequence
Deep sequencing3085 reads, 133 experiments
Evidence experimental; Illumina [1-3,5], Northern [4]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
4
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
5
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).