Stem-loop sequence hsa-mir-3199-1

AccessionMI0014247 (change log)
Symbol HGNC:MIR3199-1
DescriptionHomo sapiens miR-3199-1 stem-loop
Gene family MIPF0001026; mir-3199
Stem-loop
            -                              -  u 
5' ggugacucc agggacugccuuaggagaaaguuucuggaa gu c
   ||||||||| |||||||||||||||||||||||||||||| ||  
3' ucacugagg ucccugacggaauccucuuucaaagaccuu ca u
            g                              a  g 
Get sequence
Deep sequencing
639 reads, 0 reads per million, 128 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 27920525-27920612 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3199-1
hsa-mir-3199-2chr22: 27920526-27920611 [+]
hsa-mir-3199-1chr22: 27920525-27920612 [-]
Database links

Mature sequence hsa-miR-3199

Accession MIMAT0015084
Sequence

10 - 

agggacugccuuaggagaaaguu

 - 32

Get sequence
Deep sequencing852 reads, 116 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).