Stem-loop sequence hsa-mir-3197

AccessionMI0014245 (change log)
Symbol HGNC:MIR3197
DescriptionHomo sapiens miR-3197 stem-loop
Literature search

4 open access papers mention hsa-mir-3197
(5 sentences)

Stem-loop
              g  ca  c    a    c  g ga g 
5' ggcgaggggag cg  gg ucgg aagg gc c  g c
   ||||||||||| ||  || |||| |||| || |  |  
3' ucgcuccucuc gc  cc agcc uucc cg g  c u
              -  ca  u    c    u  - -a c 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 41167557-41167629 [+]
sense
OTTHUMT00000195007 ; IGSF5-003; intron 2
OTTHUMT00000195005 ; IGSF5-001; intron 8
ENST00000459922 ; IGSF5-003; intron 2
ENST00000380588 ; IGSF5-001; intron 8
Database links

Mature sequence hsa-miR-3197

Accession MIMAT0015082
Sequence

8 - 

ggaggcgcaggcucggaaaggcg

 - 30

Get sequence
Deep sequencing40 reads, 21 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).