Stem-loop sequence hsa-mir-3194

AccessionMI0014239 (change log)
Symbol HGNC:MIR3194
DescriptionHomo sapiens miR-3194 stem-loop
Literature search

1 open access papers mention hsa-mir-3194
(3 sentences)

Stem-loop
           gg     ccac   g        g  c 
5' agguggca  gccag    cag agggcugc ug c
   ||||||||  |||||    ||| |||||||| || a
3' uccacugu  cgguc    guc ucucgacg gc c
           ga     acuc   g        g  c 
Get sequence
Deep sequencing
284 reads, 0 reads per million, 84 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 51452905-51452977 [-]
intergenic
Database links

Mature sequence hsa-miR-3194-5p

Accession MIMAT0015078
Previous IDshsa-miR-3194
Sequence

10 - 

ggccagccaccaggagggcug

 - 30

Get sequence
Deep sequencing151 reads, 62 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-3194-3p

Accession MIMAT0019218
Sequence

45 - 

agcucugcugcucacuggcagu

 - 66

Get sequence
Deep sequencing131 reads, 50 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).