Stem-loop sequence hsa-mir-3193

AccessionMI0014238 (change log)
Symbol HGNC:MIR3193
DescriptionHomo sapiens miR-3193 stem-loop
Gene family MIPF0001401; mir-3193
Literature search

1 open access papers mention hsa-mir-3193
(4 sentences)

Stem-loop
         g     u   a  -    -  c 
5' uccugc uagga cug gg agug ga g
   |||||| ||||| ||| || |||| ||  
3' aggacg guccu gac cc uuac cu a
         a     c   -  a    u  g 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 31607186-31607240 [+]
sense
OTTHUMT00000078652 ; BPIFB2-001; intron 10
ENST00000170150 ; BPIFB2-001; intron 10
Database links

Mature sequence hsa-miR-3193

Accession MIMAT0015077
Sequence

1 - 

uccugcguaggaucugaggagu

 - 22

Get sequence
Deep sequencing24 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).