Stem-loop sequence hsa-mir-3192

AccessionMI0014237 (change log)
Symbol HGNC:MIR3192
DescriptionHomo sapiens miR-3192 stem-loop
Gene family MIPF0001597; mir-3192
Literature search

4 open access papers mention hsa-mir-3192
(5 sentences)

Stem-loop
           --uu        u  uag   u    a   u 
5' ggaaggga    cugggagg ug   cag ggaa aag u
   ||||||||    |||||||| ||   ||| |||| |||  
3' ucuuccuu    gacucucc gc   guc ccuu uuu c
           ucuc        c  -ua   u    c   u 
Get sequence
Deep sequencing
793 reads, 457 reads per million, 89 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 18470615-18470691 [+]
antisense
OTTHUMT00000078177 ; RBBP9-003; exon 3
OTTHUMT00000078178 ; RBBP9-004; exon 4
OTTHUMT00000078175 ; RBBP9-001; exon 5
ENST00000493184 ; RBBP9-003; exon 3
ENST00000491835 ; RBBP9-004; exon 4
ENST00000337227 ; RBBP9-001; exon 5
Database links

Mature sequence hsa-miR-3192-5p

Accession MIMAT0015076
Sequence

10 - 

ucugggagguuguagcaguggaa

 - 32

Get sequence
Deep sequencing611 reads, 58 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

Mature sequence hsa-miR-3192-3p

Accession MIMAT0027027
Sequence

48 - 

cucugaucgcccucucagcuc

 - 68

Get sequence
Deep sequencing11 reads, 11 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).