Stem-loop sequence hsa-mir-3191

AccessionMI0014236 (change log)
Symbol HGNC:MIR3191
DescriptionHomo sapiens miR-3191 stem-loop
Gene family MIPF0001251; mir-3190
Literature search

2 open access papers mention hsa-mir-3191
(4 sentences)

Stem-loop
             c        u    c    a   u ac 
5' ggggucaccu ucuggccg cuac uucc cac g  a
   |||||||||| |||||||| |||| |||| ||| |  a
3' ccccagugga agaccggu gaug aggg gug c  g
             c        c    c    -   c gg 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 47226944-47227019 [-]
sense
OTTHUMT00000466614 ; STRN4-022; intron 1
OTTHUMT00000466609 ; STRN4-006; intron 3
OTTHUMT00000466613 ; STRN4-021; intron 5
OTTHUMT00000466616 ; STRN4-020; intron 5
OTTHUMT00000466615 ; STRN4-018; intron 6
OTTHUMT00000466612 ; STRN4-005; intron 7
OTTHUMT00000466607 ; STRN4-001; intron 12
OTTHUMT00000466606 ; STRN4-002; intron 12
OTTHUMT00000466610 ; STRN4-004; intron 13
ENST00000598074 ; STRN4-022; intron 1
ENST00000594581 ; STRN4-006; intron 3
ENST00000594287 ; STRN4-021; intron 5
ENST00000601631 ; STRN4-020; intron 5
ENST00000594357 ; STRN4-018; intron 6
ENST00000595357 ; STRN4-005; intron 7
ENST00000263280 ; STRN4-001; intron 12
ENST00000391910 ; STRN4-002; intron 12
ENST00000539396 ; STRN4-004; intron 13
Clustered miRNAs
< 10kb from hsa-mir-3191
hsa-mir-3191chr19: 47226944-47227019 [-]
hsa-mir-3190chr19: 47226942-47227021 [+]
Database links

Mature sequence hsa-miR-3191-5p

Accession MIMAT0022732
Sequence

9 - 

cucucuggccgucuaccuucca

 - 30

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-3191-3p

Accession MIMAT0015075
Previous IDshsa-miR-3191
Sequence

46 - 

uggggacguagcuggccagacag

 - 68

Get sequence
Deep sequencing73 reads, 27 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).