Stem-loop sequence hsa-mir-3190

AccessionMI0014235 (change log)
Symbol HGNC:MIR3190
DescriptionHomo sapiens miR-3190 stem-loop
Gene family MIPF0001251; mir-3190
Literature search

2 open access papers mention hsa-mir-3190
(2 sentences)

Stem-loop
               g       ag    -g   c   -   c 
5' cuggggucaccu ucuggcc  cuac  ucc cac ggc c
   |||||||||||| |||||||  ||||  ||| ||| |||  
3' ggccccagugga agaccgg  gaug  agg gug cug u
               g       ca    ga   u   a   u 
Get sequence
Deep sequencing
804 reads, 12.2 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 47226942-47227021 [+]
antisense
OTTHUMT00000466614 ; STRN4-022; intron 1
OTTHUMT00000466609 ; STRN4-006; intron 3
OTTHUMT00000466613 ; STRN4-021; intron 5
OTTHUMT00000466616 ; STRN4-020; intron 5
OTTHUMT00000466615 ; STRN4-018; intron 6
OTTHUMT00000466612 ; STRN4-005; intron 7
OTTHUMT00000466607 ; STRN4-001; intron 12
OTTHUMT00000466606 ; STRN4-002; intron 12
OTTHUMT00000466610 ; STRN4-004; intron 13
ENST00000598074 ; STRN4-022; intron 1
ENST00000594581 ; STRN4-006; intron 3
ENST00000594287 ; STRN4-021; intron 5
ENST00000601631 ; STRN4-020; intron 5
ENST00000594357 ; STRN4-018; intron 6
ENST00000595357 ; STRN4-005; intron 7
ENST00000263280 ; STRN4-001; intron 12
ENST00000391910 ; STRN4-002; intron 12
ENST00000539396 ; STRN4-004; intron 13
Clustered miRNAs
< 10kb from hsa-mir-3190
hsa-mir-3190chr19: 47226942-47227021 [+]
hsa-mir-3191chr19: 47226944-47227019 [-]
Database links

Mature sequence hsa-miR-3190-5p

Accession MIMAT0015073
Previous IDshsa-miR-3190-5p;hsa-miR-3190
Sequence

14 - 

ucuggccagcuacgucccca

 - 33

Get sequence
Deep sequencing16 reads, 11 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3190-3p

Accession MIMAT0022839
Sequence

47 - 

uguggaagguagacggccagaga

 - 69

Get sequence
Deep sequencing762 reads, 63 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).