Stem-loop sequence hsa-mir-3189

AccessionMI0014233 (change log)
Symbol HGNC:MIR3189
DescriptionHomo sapiens miR-3189 stem-loop
Literature search

1 open access papers mention hsa-mir-3189
(1 sentences)

Stem-loop
     c  a           ugu    -u   ----    a 
5' gc uc guugccccauc   gccc  ggg    uagg a
   || || |||||||||||   ||||  |||    |||| u
3' cg ag cgaugggguag   uggg  ccc    gucc a
     u  c           -uc    uu   cuag    u 
Get sequence
Deep sequencing
134 reads, 2.44 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 18386562-18386634 [+]
intergenic
Database links

Mature sequence hsa-miR-3189-5p

Accession MIMAT0019217
Sequence

9 - 

ugccccaucugugcccuggguagga

 - 33

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3189-3p

Accession MIMAT0015071
Previous IDshsa-miR-3189
Sequence

46 - 

cccuugggucugaugggguag

 - 66

Get sequence
Deep sequencing53 reads, 11 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).