Stem-loop sequence hsa-mir-3187

AccessionMI0014231 (change log)
Symbol HGNC:MIR3187
DescriptionHomo sapiens miR-3187 stem-loop
Literature search

2 open access papers mention hsa-mir-3187
(3 sentences)

Stem-loop
             g     -gu      g    ucacc 
5' gcuggcccug gcagc   guggcu aagg     a
   |||||||||| |||||   |||||| ||||      
3' cgaccggggc cgucg   uaccgg uucc     u
             g     ggg      -    ucuug 
Get sequence
Deep sequencing
681 reads, 2.94 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 813584-813653 [+]
antisense
OTTHUMT00000379097 ; LPPR3-002; exon 7
OTTHUMT00000379096 ; LPPR3-001; exon 8
ENST00000359894 ; LPPR3-002; exon 7
ENST00000520876 ; LPPR3-001; exon 8
Clustered miRNAs
< 10kb from hsa-mir-3187
hsa-mir-4745chr19: 804940-805001 [+]
hsa-mir-3187chr19: 813584-813653 [+]
Database links

Mature sequence hsa-miR-3187-5p

Accession MIMAT0019216
Sequence

7 - 

ccugggcagcguguggcugaagg

 - 29

Get sequence
Deep sequencing51 reads, 29 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-3187-3p

Accession MIMAT0015069
Previous IDshsa-miR-3187
Sequence

44 - 

uuggccauggggcugcgcgg

 - 63

Get sequence
Deep sequencing628 reads, 60 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).