Stem-loop sequence hsa-mir-3185

AccessionMI0014227 (change log)
Symbol HGNC:MIR3185
DescriptionHomo sapiens miR-3185 stem-loop
Literature search

3 open access papers mention hsa-mir-3185
(5 sentences)

Stem-loop
   -ga     aga         uc  -       gag 
5'    augga   agaaggcgg  gg ucugcgg   c
      |||||   |||||||||  || |||||||    
3'    uaccu   ucuuccgcc  cc agacgcc   c
   cug     --g         ua  g       gga 
Get sequence
Deep sequencing
35 reads, 6.25 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 48724408-48724475 [-]
antisense
OTTHUMT00000368084 ; ABCC3-002; intron 1
OTTHUMT00000368083 ; ABCC3-001; intron 1
OTTHUMT00000368085 ; ABCC3-003; intron 1
OTTHUMT00000368086 ; ABCC3-004; intron 1
OTTHUMT00000368089 ; ABCC3-007; intron 2
ENST00000427699 ; ABCC3-002; intron 1
ENST00000285238 ; ABCC3-001; intron 1
ENST00000502426 ; ABCC3-003; intron 1
ENST00000505699 ; ABCC3-004; intron 1
ENST00000513511 ; ABCC3-007; intron 2
Database links

Mature sequence hsa-miR-3185

Accession MIMAT0015065
Sequence

8 - 

agaagaaggcggucggucugcgg

 - 30

Get sequence
Deep sequencing31 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).