Stem-loop sequence hsa-mir-3184

AccessionMI0014226 (change log)
Symbol HGNC:MIR3184
DescriptionHomo sapiens miR-3184 stem-loop
Literature search

3 open access papers mention hsa-mir-3184
(4 sentences)

Stem-loop
      ca  a         cuc   c    -     gga 
5' aag  ag cugaggggc   aga cgag cuuuu   a
   |||  || |||||||||   ||| |||| |||||   a
3' uuc  uc gacuccccg   ucu gcuc gaaaa   a
      aa  c         -uc   c    u     gau 
Get sequence
Deep sequencing
76 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 30117086-30117160 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3184
hsa-mir-3184chr17: 30117086-30117160 [-]
hsa-mir-423chr17: 30117079-30117172 [+]
Database links

Mature sequence hsa-miR-3184-5p

Accession MIMAT0015064
Previous IDshsa-miR-3184
Sequence

10 - 

ugaggggccucagaccgagcuuuu

 - 33

Get sequence
Deep sequencing45 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-3184-3p

Accession MIMAT0022731
Sequence

44 - 

aaagucucgcucucugccccuca

 - 66

Get sequence
Deep sequencing25 reads, 14 experiments
Evidence not experimental
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).