Stem-loop sequence hsa-mir-3183

AccessionMI0014225 (change log)
Symbol HGNC:MIR3183
DescriptionHomo sapiens miR-3183 stem-loop
Stem-loop
          -  g        --    u   u     cag  a  u 
5' cucugcc cu ccucucuc  ggag cgc cggag   uc cg u
   ||||||| || ||||||||  |||| ||| |||||   || ||  
3' gggacgg ga ggagggag  ccuc gcg gccuc   ag gc g
          a  -        cu    c   -     cua  -  a 
Get sequence
Deep sequencing
110 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 1022476-1022559 [-]
sense
OTTHUMT00000437248 ; ABR-002; intron 1
OTTHUMT00000206675 ; ABR-001; intron 2
OTTHUMT00000437250 ; ABR-004; intron 2
OTTHUMT00000437278 ; ABR-029; intron 2
OTTHUMT00000437293 ; ABR-034; intron 2
OTTHUMT00000437279 ; ABR-031; intron 2
OTTHUMT00000437294 ; ABR-032; intron 3
ENST00000574437 ; ABR-002; intron 1
ENST00000302538 ; ABR-001; intron 2
ENST00000544583 ; ABR-004; intron 2
ENST00000575934 ; ABR-029; intron 2
ENST00000574139 ; ABR-034; intron 2
ENST00000570525 ; ABR-031; intron 2
ENST00000574266 ; ABR-032; intron 3
Database links

Mature sequence hsa-miR-3183

Accession MIMAT0015063
Sequence

10 - 

gccucucucggagucgcucgga

 - 31

Get sequence
Deep sequencing90 reads, 27 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).