Stem-loop sequence hsa-mir-3177

AccessionMI0014211 (change log)
Symbol HGNC:MIR3177
DescriptionHomo sapiens miR-3177 stem-loop
Literature search

2 open access papers mention hsa-mir-3177
(2 sentences)

Stem-loop
      c           aca  c     ag       cu      
5' cca gugccaugugu   ca gugcc  gcgcugu  ugaga 
   ||| |||||||||||   || |||||  |||||||  |||| c
3' ggu cacggugcaca   gu cacgg  cgugacg  gcuua 
      -           ggg  -     ca       -c      
Get sequence
Deep sequencing
664 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 1734985-1735066 [+]
sense
OTTHUMT00000432989 ; HN1L-003; intron 1
OTTHUMT00000109086 ; HN1L-001; intron 1
OTTHUMT00000432990 ; HN1L-008; intron 1
OTTHUMT00000432992 ; HN1L-006; intron 1
OTTHUMT00000432994 ; HN1L-014; intron 1
OTTHUMT00000432998 ; HN1L-010; intron 1
OTTHUMT00000432999 ; HN1L-004; intron 1
OTTHUMT00000432991 ; HN1L-002; intron 2
OTTHUMT00000432993 ; HN1L-009; intron 2
OTTHUMT00000432995 ; HN1L-011; intron 2
OTTHUMT00000432996 ; HN1L-005; intron 2
OTTHUMT00000432813 ; LA16c-431H6.6-001; intron 21
ENST00000569256 ; HN1L-003; intron 1
ENST00000248098 ; HN1L-001; intron 1
ENST00000567717 ; HN1L-008; intron 1
ENST00000561516 ; HN1L-006; intron 1
ENST00000566742 ; HN1L-014; intron 1
ENST00000566691 ; HN1L-010; intron 1
ENST00000382710 ; HN1L-004; intron 1
ENST00000562684 ; HN1L-002; intron 2
ENST00000382711 ; HN1L-009; intron 2
ENST00000566925 ; HN1L-011; intron 2
ENST00000569765 ; HN1L-005; intron 2
ENST00000454337 ; LA16c-431H6.6-001; intron 21
Database links

Mature sequence hsa-miR-3177-5p

Accession MIMAT0019215
Sequence

11 - 

uguguacacacgugccaggcgcu

 - 33

Get sequence
Deep sequencing42 reads, 18 experiments
Evidence experimental; Illumina [2-3]
Predicted targets

Mature sequence hsa-miR-3177-3p

Accession MIMAT0015054
Previous IDshsa-miR-3177
Sequence

54 - 

ugcacggcacuggggacacgu

 - 74

Get sequence
Deep sequencing618 reads, 54 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).