Stem-loop sequence hsa-mir-3175

AccessionMI0014209 (change log)
Symbol HGNC:MIR3175
DescriptionHomo sapiens miR-3175 stem-loop
Literature search

4 open access papers mention hsa-mir-3175
(5 sentences)

Stem-loop
         --   c         a   ag      cug  c 
5' ccuggg  ggg ggggagaga cgc  ugacgu   gc g
   ||||||  ||| ||||||||| |||  ||||||   || c
3' ggaccc  ccc cuccucuuu gcg  gcugua   cg g
         au   c         c   -g      -cg  u 
Get sequence
Deep sequencing
247 reads, 1.69 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 92904399-92904475 [+]
intergenic
Database links

Mature sequence hsa-miR-3175

Accession MIMAT0015052
Sequence

10 - 

cggggagagaacgcagugacgu

 - 31

Get sequence
Deep sequencing225 reads, 49 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).