Stem-loop sequence hsa-mir-3174

AccessionMI0014208 (change log)
Symbol HGNC:MIR3174
DescriptionHomo sapiens miR-3174 stem-loop
Gene family MIPF0001569; mir-3174
Literature search

2 open access papers mention hsa-mir-3174
(2 sentences)

Stem-loop
         ug   -       a          gc  ---u  ---   c 
5' guuacc  gua gugaguu gagaugcaga  cc    gg   gcu c
   ||||||  ||| ||||||| ||||||||||  ||    ||   |||  
3' uaaugg  cgu cacuuaa uuuuacgucu  gg    cc   cga u
         ua   a       -          -a  ucau  aaa   c 
Get sequence
Deep sequencing
510 reads, 0 reads per million, 81 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 90006755-90006841 [+]
antisense
ENST00000544600 ; RHCG-201; intron 9
Database links

Mature sequence hsa-miR-3174

Accession MIMAT0015051
Sequence

10 - 

uagugaguuagagaugcagagcc

 - 32

Get sequence
Deep sequencing452 reads, 72 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).