Stem-loop sequence hsa-mir-3173

AccessionMI0014204 (change log)
Symbol HGNC:MIR3173
DescriptionHomo sapiens miR-3173 stem-loop
Gene family MIPF0001383; mir-3173
Literature search

3 open access papers mention hsa-mir-3173
(7 sentences)

Stem-loop
         c                     ga  u 
5' ucccug ccugccuguuuucuccuuugu  uu u
   |||||| |||||||||||||||||||||  ||  
3' agggac ggacggauaaaggaggaaaca  ag a
         c                     ag  u 
Get sequence
Deep sequencing
808 reads, 7.07 reads per million, 99 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 95137919-95137986 [-]
intergenic
Database links

Mature sequence hsa-miR-3173-5p

Accession MIMAT0019214
Sequence

5 - 

ugcccugccuguuuucuccuuu

 - 26

Get sequence
Deep sequencing315 reads, 75 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-3173-3p

Accession MIMAT0015048
Previous IDshsa-miR-3173
Sequence

43 - 

aaaggaggaaauaggcaggcca

 - 64

Get sequence
Deep sequencing486 reads, 54 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).