Stem-loop sequence hsa-mir-3171

AccessionMI0014202 (change log)
Symbol HGNC:MIR3171
DescriptionHomo sapiens miR-3171 stem-loop
Stem-loop
             gaug                  c   a 
5' uauauauaga    uauggaaucuguauauau uau u
   ||||||||||    |||||||||||||||||| |||  
3' guauauaucu    auaccuuagauauauaug gua a
             --aa                  u   u 
Get sequence
Deep sequencing
257 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 27633205-27633278 [-]
intergenic
Database links

Mature sequence hsa-miR-3171

Accession MIMAT0015046
Sequence

10 - 

agauguauggaaucuguauauauc

 - 33

Get sequence
Deep sequencing64 reads, 18 experiments
Evidence experimental; Illumina [1-2], Northern [3]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).