Stem-loop sequence hsa-mir-3170

AccessionMI0014201 (change log)
Symbol HGNC:MIR3170
DescriptionHomo sapiens miR-3170 stem-loop
Gene family MIPF0001637; mir-3170
Stem-loop
            cu               a       agc 
5' cugguaaca  gggguucugagacag caguguu   u
   |||||||||  ||||||||||||||| |||||||   c
3' gaccauugu  ccccaagauucuguc guuacga   c
            au               c       aga 
Get sequence
Deep sequencing
87 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 98208524-98208600 [+]
intergenic
Database links

Mature sequence hsa-miR-3170

Accession MIMAT0015045
Sequence

10 - 

cugggguucugagacagacagu

 - 31

Get sequence
Deep sequencing86 reads, 31 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).