Stem-loop sequence hsa-mir-3169

AccessionMI0014200 (change log)
Symbol HGNC:MIR3169
DescriptionHomo sapiens miR-3169 stem-loop
Literature search

1 open access papers mention hsa-mir-3169
(1 sentences)

Stem-loop
                                    c  aaag 
5' augugaaaacauaggacugugcuuggcacauag ac    u
   ||||||||||||||||||||||||||||||||| ||    c
3' uacauuuuuguguccugauacgaaccguguguc ug    u
                                    a  guau 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 61199798-61199880 [-]
intergenic
Database links

Mature sequence hsa-miR-3169

Accession MIMAT0015044
Sequence

12 - 

uaggacugugcuuggcacauag

 - 33

Get sequence
Deep sequencing23 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).