Stem-loop sequence hsa-mir-3167

AccessionMI0014198 (change log)
Symbol HGNC:MIR3167
DescriptionHomo sapiens miR-3167 stem-loop
Gene family MIPF0001823; mir-3167
Literature search

1 open access papers mention hsa-mir-3167
(1 sentences)

Stem-loop
         -  a                       uuu       a 
5' ggcugu gg ggcaccaguauuucugaaauucu   uucugaa u
   |||||| || |||||||||||||||||||||||   |||||||  
3' ccgaca cc cuguggucauaaagacuuuagga   aggacuu u
         g  -                       ---       c 
Get sequence
Deep sequencing
238 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 126988458-126988542 [-]
intergenic
Database links

Mature sequence hsa-miR-3167

Accession MIMAT0015042
Sequence

54 - 

aggauuucagaaauacuggugu

 - 75

Get sequence
Deep sequencing51 reads, 18 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).