Stem-loop sequence hsa-mir-3165

AccessionMI0014195 (change log)
Symbol HGNC:MIR3165
DescriptionHomo sapiens miR-3165 stem-loop
Gene family MIPF0001635; mir-3165
Stem-loop
          c                       ----  u 
5' ccggugg aagguggaugcaaugugaccuca    ac c
   ||||||| |||||||||||||||||||||||    || u
3' ggucacc uuccaccuauguuacacuggagu    ug u
          a                       cucc  g 
Get sequence
Deep sequencing
136 reads, 1.92 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 72072228-72072302 [-]
sense
OTTHUMT00000396994 ; CLPB-012; intron 2
OTTHUMT00000396892 ; CLPB-002; intron 3
OTTHUMT00000396893 ; CLPB-004; intron 3
OTTHUMT00000396992 ; CLPB-010; intron 3
OTTHUMT00000396890 ; CLPB-003; intron 4
OTTHUMT00000396895 ; CLPB-005; intron 4
OTTHUMT00000396993 ; CLPB-011; intron 4
OTTHUMT00000396889 ; CLPB-001; intron 5
OTTHUMT00000396896 ; CLPB-009; intron 5
OTTHUMT00000396891 ; CLPB-006; intron 6
ENST00000536297 ; CLPB-012; intron 2
ENST00000340729 ; CLPB-002; intron 3
ENST00000543042 ; CLPB-004; intron 3
ENST00000544683 ; CLPB-010; intron 3
ENST00000538039 ; CLPB-003; intron 4
ENST00000535477 ; CLPB-005; intron 4
ENST00000539148 ; CLPB-011; intron 4
ENST00000294053 ; CLPB-001; intron 5
ENST00000445069 ; CLPB-009; intron 5
ENST00000535990 ; CLPB-006; intron 6
ENST00000437826 ; CLPB-201; intron 6
antisense
OTTHUMT00000396900 ; RP11-45F15.2-001; intron 2
ENST00000537727 ; RP11-45F15.2-001; intron 2
Database links

Mature sequence hsa-miR-3165

Accession MIMAT0015039
Sequence

10 - 

agguggaugcaaugugaccuca

 - 31

Get sequence
Deep sequencing98 reads, 36 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).