Stem-loop sequence hsa-mir-3163

AccessionMI0014193 (change log)
Symbol HGNC:MIR3163
DescriptionHomo sapiens miR-3163 stem-loop
Literature search

2 open access papers mention hsa-mir-3163
(6 sentences)

Stem-loop
   u                 a   c        cuuc 
5'  uccucaucuauaaaaug ggg aguaagac    c
    ||||||||||||||||| ||| ||||||||    u
3'  aggaguagauauuuuac ccc ucauucug    u
   a                 c   a        uucc 
Get sequence
Deep sequencing
111 reads, 4.35 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 66934434-66934506 [-]
antisense
OTTHUMT00000393139 ; KDM2A-001; intron 2
OTTHUMT00000393140 ; KDM2A-002; intron 2
OTTHUMT00000393142 ; KDM2A-012; intron 2
ENST00000398645 ; KDM2A-001; intron 2
ENST00000529006 ; KDM2A-002; intron 2
ENST00000527157 ; KDM2A-012; intron 2
Database links

Mature sequence hsa-miR-3163

Accession MIMAT0015037
Sequence

10 - 

uauaaaaugagggcaguaagac

 - 31

Get sequence
Deep sequencing79 reads, 35 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).