Stem-loop sequence hsa-mir-3161

AccessionMI0014191 (change log)
Symbol HGNC:MIR3161
DescriptionHomo sapiens miR-3161 stem-loop
Literature search

2 open access papers mention hsa-mir-3161
(2 sentences)

Stem-loop
     uc a     -ga                 -    aag 
5' cc  g gagcu   uaagaacagaggcccag auug   u
   ||  | |||||   ||||||||||||||||| ||||    
3' gg  c cuuga   auuuuuguuuccggguc ugau   u
     uc -     acc                 g    aag 
Get sequence
Deep sequencing
119 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 48096782-48096858 [+]
sense
OTTHUMT00000390525 ; PTPRJ-001; intron 1
OTTHUMT00000390526 ; PTPRJ-002; intron 1
OTTHUMT00000391127 ; PTPRJ-006; intron 1
OTTHUMT00000390527 ; PTPRJ-003; intron 1
OTTHUMT00000390528 ; PTPRJ-004; intron 2
ENST00000418331 ; PTPRJ-001; intron 1
ENST00000440289 ; PTPRJ-002; intron 1
ENST00000534219 ; PTPRJ-006; intron 1
ENST00000527952 ; PTPRJ-003; intron 1
ENST00000526550 ; PTPRJ-004; intron 2
Database links

Mature sequence hsa-miR-3161

Accession MIMAT0015035
Sequence

10 - 

cugauaagaacagaggcccagau

 - 32

Get sequence
Deep sequencing110 reads, 35 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).