Stem-loop sequence hsa-mir-3160-1

AccessionMI0014189 (change log)
Symbol HGNC:MIR3160-1
DescriptionHomo sapiens miR-3160-1 stem-loop
Gene family MIPF0001028; mir-3160
Literature search

1 open access papers mention hsa-mir-3160-1
(1 sentences)

Stem-loop
                                      --       
5' ggaccugcccugggcuuucuagucucagcucuccu  ccagcu 
   |||||||||||||||||||||||||||||||||||  ||||| c
3' cuuggacgggacccgaaagaucagagucgagagga  ggucga 
                                      cu       
Get sequence
Deep sequencing
157 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 46451805-46451889 [-]
sense
OTTHUMT00000390102 ; AMBRA1-001; intron 13
OTTHUMT00000390154 ; AMBRA1-007; intron 13
OTTHUMT00000390100 ; AMBRA1-002; intron 14
OTTHUMT00000390103 ; AMBRA1-005; intron 14
OTTHUMT00000390099 ; AMBRA1-006; intron 15
ENST00000534300 ; AMBRA1-001; intron 13
ENST00000528950 ; AMBRA1-007; intron 13
ENST00000426438 ; AMBRA1-202; intron 13
ENST00000298834 ; AMBRA1-201; intron 13
ENST00000533727 ; AMBRA1-002; intron 14
ENST00000458649 ; AMBRA1-005; intron 14
ENST00000314845 ; AMBRA1-006; intron 15
Clustered miRNAs
< 10kb from hsa-mir-3160-1
hsa-mir-3160-2chr11: 46451807-46451887 [+]
hsa-mir-3160-1chr11: 46451805-46451889 [-]
Database links

Mature sequence hsa-miR-3160-5p

Accession MIMAT0019212
Sequence

13 - 

ggcuuucuagucucagcucucc

 - 34

Get sequence
Deep sequencing30 reads, 13 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3160-3p

Accession MIMAT0015034
Previous IDshsa-miR-3160
Sequence

54 - 

agagcugagacuagaaagccca

 - 75

Get sequence
Deep sequencing256 reads, 51 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).