Stem-loop sequence hsa-mir-3159

AccessionMI0014188 (change log)
Symbol HGNC:MIR3159
DescriptionHomo sapiens miR-3159 stem-loop
Stem-loop
          c  a        a    c      -gg    
5' ccaaagu cu ggauuaca gugu ggccac   gcu 
   ||||||| || |||||||| |||| ||||||   || g
3' gguuuua ga ccuaaugu cgca ucggug   cgg 
          c  c        c    c      aca    
Get sequence
Deep sequencing
8040 reads, 639 reads per million, 168 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 18387787-18387860 [+]
sense
OTTHUMT00000395629 ; GTF2H1-010; exon 8
OTTHUMT00000395623 ; GTF2H1-003; exon 14
OTTHUMT00000395627 ; GTF2H1-001; exon 15
OTTHUMT00000395620 ; GTF2H1-002; exon 16
ENST00000530496 ; GTF2H1-010; exon 8
ENST00000534641 ; GTF2H1-003; exon 14
ENST00000265963 ; GTF2H1-001; exon 15
ENST00000453096 ; GTF2H1-002; exon 16
Database links

Mature sequence hsa-miR-3159

Accession MIMAT0015033
Sequence

10 - 

uaggauuacaagugucggccac

 - 31

Get sequence
Deep sequencing216 reads, 52 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).