Stem-loop sequence hsa-mir-3157

AccessionMI0014185 (change log)
Symbol HGNC:MIR3157
DescriptionHomo sapiens miR-3157 stem-loop
Literature search

3 open access papers mention hsa-mir-3157
(3 sentences)

Stem-loop
                  c       u      ugcu ug g   a 
5' gggaagggcuucagc aggcuag gcaguc    u  u cca c
   ||||||||||||||| ||||||| ||||||    |  | |||  
3' cccuuuucgaagucg ucugauc cgucag    a  g ggu a
                  a       c      ---u gu g   c 
Get sequence
Deep sequencing
1030 reads, 0 reads per million, 100 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 96064315-96064399 [-]
antisense
OTTHUMT00000049469 ; PLCE1-001; 3'UTR (exon 24)
OTTHUMT00000049470 ; PLCE1-002; 3'UTR (exon 24)
ENST00000371380 ; PLCE1-001; 3'UTR (exon 24)
ENST00000371375 ; PLCE1-002; 3'UTR (exon 24)
ENST00000371385 ; PLCE1-202; 3'UTR (exon 24)
ENST00000260766 ; PLCE1-201; 3'UTR (exon 25)
Database links

Mature sequence hsa-miR-3157-5p

Accession MIMAT0015031
Previous IDshsa-miR-3157
Sequence

10 - 

uucagccaggcuagugcagucu

 - 31

Get sequence
Deep sequencing905 reads, 84 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-3157-3p

Accession MIMAT0019210
Sequence

58 - 

cugcccuagucuagcugaagcu

 - 79

Get sequence
Deep sequencing121 reads, 51 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).