Stem-loop sequence hsa-mir-3155a

AccessionMI0014183 (change log)
Previous IDshsa-mir-3155
Symbol HGNC:MIR3155A
DescriptionHomo sapiens miR-3155a stem-loop
Gene family MIPF0001242; mir-3155
Stem-loop
              cc                      cc   c 
5' uccgggcauca  ucccacugcagagccuggggag  gga a
   |||||||||||  ||||||||||||||||||||||  |||  
3' agguccguagu  agggugacgucucggacccuuc  ccu g
              ca                      --   c 
Get sequence
Deep sequencing
197 reads, 2.99 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 6152196-6152277 [+]
sense
OTTHUMT00000046642 ; RBM17-010; intron 2
OTTHUMT00000046641 ; RBM17-009; intron 4
OTTHUMT00000046637 ; RBM17-005; intron 6
OTTHUMT00000046635 ; RBM17-003; intron 7
ENST00000481147 ; RBM17-010; intron 2
ENST00000447032 ; RBM17-009; intron 4
ENST00000437845 ; RBM17-005; intron 6
ENST00000379888 ; RBM17-003; intron 7
ENST00000446108 ; RBM17-201; intron 7
Clustered miRNAs
< 10kb from hsa-mir-3155a
hsa-mir-3155achr10: 6152196-6152277 [+]
hsa-mir-3155bchr10: 6152207-6152262 [-]
Database links

Mature sequence hsa-miR-3155a

Accession MIMAT0015029
Previous IDshsa-miR-3155
Sequence

52 - 

ccaggcucugcagugggaacu

 - 72

Get sequence
Deep sequencing63 reads, 30 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).