Stem-loop sequence hsa-mir-3154

AccessionMI0014182 (change log)
Symbol HGNC:MIR3154
DescriptionHomo sapiens miR-3154 stem-loop
Gene family MIPF0001387; mir-3154
Literature search

1 open access papers mention hsa-mir-3154
(1 sentences)

Stem-loop
     -      cu   ca  -          g  caccc     -a gu 
5' gg ccccuc  ucu  gc cccagcuccc cu     cugcc  c  c
   || ||||||  |||  || |||||||||| ||     |||||  |   
3' cc ggggag  aga  cg ggguugaggg ga     gacgg  g  a
     a      --   --  a          -  ----a     ag aa 
Get sequence
Deep sequencing
261 reads, 1.59 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Goff et al. [2] and Stark et al. [3] later validated its expression in human using high-throughput sequencing.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 128244947-128245030 [-]
sense
OTTHUMT00000054087 ; MAPKAP1-004; intron 1
OTTHUMT00000355311 ; MAPKAP1-018; intron 2
OTTHUMT00000355309 ; MAPKAP1-016; intron 5
OTTHUMT00000054088 ; MAPKAP1-005; intron 6
OTTHUMT00000355308 ; MAPKAP1-015; intron 8
OTTHUMT00000054092 ; MAPKAP1-009; intron 8
OTTHUMT00000054090 ; MAPKAP1-007; intron 8
OTTHUMT00000054091 ; MAPKAP1-008; intron 8
ENST00000444226 ; MAPKAP1-004; intron 1
ENST00000496063 ; MAPKAP1-018; intron 2
ENST00000373497 ; MAPKAP1-202; intron 4
ENST00000497932 ; MAPKAP1-016; intron 5
ENST00000420643 ; MAPKAP1-005; intron 6
ENST00000394063 ; MAPKAP1-203; intron 7
ENST00000373511 ; MAPKAP1-015; intron 8
ENST00000373498 ; MAPKAP1-009; intron 8
ENST00000350766 ; MAPKAP1-007; intron 8
ENST00000373503 ; MAPKAP1-008; intron 8
ENST00000265960 ; MAPKAP1-201; intron 9
Clustered miRNAs
< 10kb from hsa-mir-3154
hsa-mir-3154chr9: 128244947-128245030 [-]
hsa-mir-199bchr9: 128244721-128244830 [-]
Database links

Mature sequence hsa-miR-3154

Accession MIMAT0015028
Sequence

54 - 

cagaaggggaguugggagcaga

 - 75

Get sequence
Deep sequencing237 reads, 54 experiments
Evidence experimental; SOLiD [2], Illumina [3-5]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).
5
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).