Stem-loop sequence hsa-mir-3153

AccessionMI0014180 (change log)
Symbol HGNC:MIR3153
DescriptionHomo sapiens miR-3153 stem-loop
Literature search

3 open access papers mention hsa-mir-3153
(3 sentences)

Stem-loop
                        uc c   c         aa 
5' gacaaauuuuaaaugucccug  c cuu cccccaauu  a
   |||||||||||||||||||||  | ||| |||||||||   
3' uuguuuaaaauuuacagggau  g gaa ggggguuag  g
                        ga c   a         au 
Get sequence
Deep sequencing
105 reads, 0 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 89312225-89312306 [+]
intergenic
Database links

Mature sequence hsa-miR-3153

Accession MIMAT0015026
Sequence

50 - 

ggggaaagcgaguagggacauuu

 - 72

Get sequence
Deep sequencing72 reads, 16 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).