Stem-loop sequence hsa-mir-3152

AccessionMI0014179 (change log)
Symbol HGNC:MIR3152
DescriptionHomo sapiens miR-3152 stem-loop
Literature search

3 open access papers mention hsa-mir-3152
(4 sentences)

Stem-loop
                                 -a  cu 
5' gugcagaguuauugccucuguucuaacaca  ga  a
   ||||||||||||||||||||||||||||||  ||  g
3' cacgucucaauaacggggauaagauugugu  cu  g
                                 cc  uc 
Get sequence
Deep sequencing
186 reads, 19.3 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Stark et al. later validated its expression in human using high-throughput sequencing [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 18573306-18573379 [+]
sense
OTTHUMT00000401206 ; ADAMTSL1-012; intron 3
OTTHUMT00000051800 ; ADAMTSL1-001; intron 3
OTTHUMT00000051803 ; ADAMTSL1-004; intron 3
OTTHUMT00000051802 ; ADAMTSL1-003; intron 3
OTTHUMT00000051801 ; ADAMTSL1-002; intron 3
OTTHUMT00000051804 ; ADAMTSL1-005; intron 3
ENST00000579801 ; MIR3152-201; exon 1
ENST00000380548 ; ADAMTSL1-012; intron 3
ENST00000327883 ; ADAMTSL1-001; intron 3
ENST00000431052 ; ADAMTSL1-004; intron 3
ENST00000380570 ; ADAMTSL1-003; intron 3
ENST00000380566 ; ADAMTSL1-002; intron 3
ENST00000276935 ; ADAMTSL1-005; intron 3
Database links

Mature sequence hsa-miR-3152-5p

Accession MIMAT0019207
Sequence

11 - 

auugccucuguucuaacacaag

 - 32

Get sequence
Deep sequencing158 reads, 48 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence hsa-miR-3152-3p

Accession MIMAT0015025
Previous IDshsa-miR-3152
Sequence

45 - 

uguguuagaauaggggcaauaa

 - 66

Get sequence
Deep sequencing27 reads, 15 experiments
Evidence experimental; Illumina [2-4]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
4
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).