Stem-loop sequence hsa-mir-3151

AccessionMI0014178 (change log)
Symbol HGNC:MIR3151
DescriptionHomo sapiens miR-3151 stem-loop
Gene family MIPF0001394; mir-3151
Literature search

6 open access papers mention hsa-mir-3151
(22 sentences)

Stem-loop
                  g aa           -----    c 
5' ggggugauggguggg c  ugggaucaggu     gccu a
   ||||||||||||||| |  |||||||||||     ||||  
3' ccccacuguccaccc g  acccuagucca     cggg a
                  - ac           cccua    a 
Get sequence
Deep sequencing
194 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 103154614-103154689 [+]
intergenic
Database links

Mature sequence hsa-miR-3151-5p

Accession MIMAT0015024
Sequence

10 - 

gguggggcaaugggaucaggu

 - 30

Get sequence
Deep sequencing183 reads, 19 experiments
Evidence experimental; Illumina [1-4]
Database links
Predicted targets

Mature sequence hsa-miR-3151-3p

Accession MIMAT0027026
Sequence

49 - 

ccugaucccacagcccaccu

 - 68

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; Illumina [4]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).
3
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).