Stem-loop sequence hsa-mir-3150b

AccessionMI0016426 (change log)
Symbol HGNC:MIR3150B
DescriptionHomo sapiens miR-3150b stem-loop
Gene family MIPF0001102; mir-3150
Stem-loop
        a                 g       c    -    g 
5' gaggg aagcaggccaaccucga gaucucc cagc cuug c
   ||||| ||||||||||||||||| ||||||| |||| |||| g
3' cuccc uucguccgguuggagcu cuagagg gucg ggac u
        c                 g       a    u    u 
Get sequence
Deep sequencing
3272 reads, 5.66 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 95072911-95072996 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3150b
hsa-mir-3150achr8: 95072914-95072993 [+]
hsa-mir-3150bchr8: 95072911-95072996 [-]
Database links

Mature sequence hsa-miR-3150b-5p

Accession MIMAT0019226
Sequence

15 - 

caaccucgaggaucuccccagc

 - 36

Get sequence
Deep sequencing99 reads, 21 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-3150b-3p

Accession MIMAT0018194
Previous IDshsa-miR-3150b
Sequence

53 - 

ugaggagaucgucgagguugg

 - 73

Get sequence
Deep sequencing3165 reads, 44 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).