Stem-loop sequence hsa-mir-3150a

AccessionMI0014177 (change log)
Previous IDshsa-mir-3150
Symbol HGNC:MIR3150A
DescriptionHomo sapiens miR-3150a stem-loop
Gene family MIPF0001102; mir-3150
Literature search

1 open access papers mention hsa-mir-3150a
(3 sentences)

Stem-loop
                       c            a c  a 
5' gggaagcaggccaaccucga gaucuccucagc c ug a
   |||||||||||||||||||| |||||||||||| | || c
3' ccuuucguccgguuggagcu cuagaggggucg g ac g
                       c            - a  c 
Get sequence
Deep sequencing
392 reads, 24.6 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 95072914-95072993 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3150a
hsa-mir-3150bchr8: 95072911-95072996 [-]
hsa-mir-3150achr8: 95072914-95072993 [+]
Database links

Mature sequence hsa-miR-3150a-5p

Accession MIMAT0019206
Sequence

12 - 

caaccucgacgaucuccucagc

 - 33

Get sequence
Deep sequencing212 reads, 39 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3150a-3p

Accession MIMAT0015023
Previous IDshsa-miR-3150
Sequence

49 - 

cuggggagauccucgagguugg

 - 70

Get sequence
Deep sequencing179 reads, 42 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).