Stem-loop sequence hsa-mir-3149

AccessionMI0014176 (change log)
Symbol HGNC:MIR3149
DescriptionHomo sapiens miR-3149 stem-loop
Gene family MIPF0001935; mir-3149
Literature search

1 open access papers mention hsa-mir-3149
(1 sentences)

Stem-loop
                            aucc   c     cau 
5' auacauacauguacacacacauguc    aca acaua   a
   |||||||||||||||||||||||||    ||| |||||    
3' uauguguguguauguguguguauag    ugu uguau   u
                            -gua   u     aua 
Get sequence
Deep sequencing
983 reads, 131 reads per million, 133 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 76966768-76966850 [-]
intergenic
Database links

Mature sequence hsa-miR-3149

Accession MIMAT0015022
Sequence

51 - 

uuuguauggauauguguguguau

 - 73

Get sequence
Deep sequencing540 reads, 90 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).