Stem-loop sequence hsa-mir-3148

AccessionMI0014175 (change log)
Symbol HGNC:MIR3148
DescriptionHomo sapiens miR-3148 stem-loop
Literature search

6 open access papers mention hsa-mir-3148
(11 sentences)

Stem-loop
           a                      a   au 
5' gaguuaag uggaaaaaacuggugugugcuu uug  g
   |||||||| |||||||||||||||||||||| |||  u
3' cucaauuc accuuuuuugacuacauacgaa aac  a
           a                      c   cg 
Get sequence
Deep sequencing
83 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 29957272-29957348 [-]
antisense
OTTHUMT00000375771 ; LEPROTL1-001; intron 1
OTTHUMT00000375790 ; LEPROTL1-006; intron 1
OTTHUMT00000375791 ; LEPROTL1-003; intron 1
OTTHUMT00000375792 ; LEPROTL1-004; intron 1
OTTHUMT00000375772 ; LEPROTL1-002; intron 1
OTTHUMT00000375848 ; LEPROTL1-008; intron 1
OTTHUMT00000375793 ; LEPROTL1-005; intron 1
ENST00000321250 ; LEPROTL1-001; intron 1
ENST00000518001 ; LEPROTL1-006; intron 1
ENST00000520682 ; LEPROTL1-003; intron 1
ENST00000442880 ; LEPROTL1-004; intron 1
ENST00000523116 ; LEPROTL1-002; intron 1
ENST00000520739 ; LEPROTL1-008; intron 1
ENST00000518192 ; LEPROTL1-005; intron 1
Database links

Mature sequence hsa-miR-3148

Accession MIMAT0015021
Sequence

10 - 

uggaaaaaacuggugugugcuu

 - 31

Get sequence
Deep sequencing82 reads, 23 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).