Stem-loop sequence hsa-mir-3147

AccessionMI0014173 (change log)
Symbol HGNC:MIR3147
DescriptionHomo sapiens miR-3147 stem-loop
Literature search

3 open access papers mention hsa-mir-3147
(3 sentences)

Stem-loop
                  u a  a   u   a   cg 
5' guccggguugggcag g gg ggg gug cgc  c
   ||||||||||||||| | || ||| ||| |||   
3' caggcucaaccuguu c cc cuc cac gug  g
                  - -  g   -   -   aa 
Get sequence
Deep sequencing
217 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 57405025-57405090 [+]
intergenic
Database links

Mature sequence hsa-miR-3147

Accession MIMAT0015019
Sequence

6 - 

gguugggcagugaggaggguguga

 - 29

Get sequence
Deep sequencing216 reads, 16 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).