Stem-loop sequence hsa-mir-3146

AccessionMI0014172 (change log)
Symbol HGNC:MIR3146
DescriptionHomo sapiens miR-3146 stem-loop
Gene family MIPF0001626; mir-3146
Literature search

1 open access papers mention hsa-mir-3146
(1 sentences)

Stem-loop
             -                  a   ---   a 
5' gcuaaguccc uucuuucuauccuaguau acu   uga g
   |||||||||| |||||||||||||||||| |||   ||| a
3' cgguucaggg aagaaagauaggaucgua uga   acu a
             u                  c   uaa   u 
Get sequence
Deep sequencing
335 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 19705358-19705436 [-]
intergenic
Database links

Mature sequence hsa-miR-3146

Accession MIMAT0015018
Sequence

50 - 

caugcuaggauagaaagaaugg

 - 71

Get sequence
Deep sequencing213 reads, 51 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).